The short version of RP-HPLC fits in a sentence. The long version — which is the one that helps — is below.
Reviewed 2026-02-09. Anything still debated is marked as such rather than presented as settled.
Thymosin beta-4 is a 43-residue actin-binding protein found in most mammalian cell types, where it participates in cytoskeletal regulation and cell migration. TB-500 represents only a short fragment of that protein and does not include the remaining residues. Whether the isolated fragment reproduces the full range of activities reported for the intact protein remains an open question. Researchers commonly treat the two as related but distinct entities when comparing results.
Published work involving this sequence spans actin-binding assays, cell-migration studies, wound-healing models, and cardiovascular or musculoskeletal experiments. Much of the biological rationale derives from in vitro systems and animal models, and the number of controlled human studies is small. Reported outcomes vary across preparations, doses, and routes, which complicates comparison between studies. Reviews generally describe the evidence base as preliminary rather than settled. Mechanistic explanations are often proposed by analogy to the parent protein rather than demonstrated directly.
Detection in biological matrices generally relies on liquid chromatography coupled with tandem mass spectrometry, because the peptide lacks a convenient ultraviolet chromophore beyond the amide backbone. Immunoassays have been described, but antibodies raised against the fragment can cross-react with the full-length protein or with unrelated peptides, so findings usually require confirmation by a second technique. Sample preparation typically involves protein precipitation followed by solid-phase extraction. Reported detection windows depend on dose, route, matrix, and instrument sensitivity.
Lyophilised material is stable for extended periods when kept dry and cold, and suppliers typically recommend storage well below freezing. Once dissolved, the peptide is handled at refrigeration temperatures and used within a short period, because peptide bonds and the acetylated terminus can be affected by repeated freeze-thaw cycles, proteases, or extreme pH. Bacteriostatic water and saline are both described as solvents, although preservatives can interfere with some analytical workflows. Reconstituted solutions are inspected for particulates before use.
| Property | Value | Notes |
|---|---|---|
| Molecular formula | C38H68N10O14 | Acetylated heptapeptide form |
| Monoisotopic mass | 888.5 Da | Average mass about 889 Da |
| Appearance | White to off-white solid | Usually supplied as lyophilised powder |
| Solubility class | Highly water soluble | Also dissolves in aqueous buffers |
| Common synonyms | Tbeta4 fragment, thymosin beta-4 (17-23) | Refer to the same sequence |
Identity and purity are checked with chromatographic and mass spectrometric methods. Reverse-phase high-performance liquid chromatography separates the peptide from related impurities, while mass spectrometry confirms the expected molecular mass. A certificate of analysis may report a purity percentage, but the laboratory should still verify the material independently. Common quality concerns include truncated sequences, deamidation, oxidation, and residual solvents from synthesis. Because TB-500 is short, some impurities can differ from the target by only a few mass units.
Reconstitution practices affect downstream measurements. The dry powder is typically dissolved in sterile water or a suitable aqueous buffer, then mixed gently rather than vortexed at high speed. Visible particles or cloudiness suggest incomplete dissolution or contamination and should be investigated. For long-term storage, aliquots should be labeled with concentration, solvent, and date. Open questions include how different buffers alter peptide conformation and whether specific container materials adsorb the peptide. Those variables can change apparent concentration in assays even when the chemical identity is correct.
Lyophilized TB-500 is hygroscopic and should be kept dry before use. The usual storage recommendation for the solid is -20 °C, protected from light and moisture. Once dissolved, the peptide is less stable, and repeated freeze-thaw cycles can promote aggregation or degradation. Laboratories often divide a reconstituted solution into single-use aliquots and store them at -80 °C. Exact stability limits depend on buffer, pH, and concentration, so published data do not define a single universal condition.
Interest in the peptide grew during the 2000s and 2010s, when studies of tendon and ligament injuries in horses reported changes in lesion size after treatment. Those reports circulated widely outside the scientific literature and shaped much of the current online discussion. Subsequent reviews noted inconsistent study design, small groups, and a shortage of independent replication. Popular descriptions often blur the line between the fragment, the complete protein, and unrelated growth factors, which complicates comparisons across sources.
TB-500 is a synthetic peptide whose sequence corresponds to a short fragment near the N-terminus of thymosin beta-4, a small protein present in most mammalian cells. The fragment is commonly cited as containing the actin-binding region of the parent molecule, which is why it appears in laboratory work on cell migration and tissue repair. Suppliers distribute it as a lyophilised powder intended for research use. Its identity is defined by amino acid sequence and by the presence of an acetyl group on the N-terminal residue.
Full-length thymosin beta-4 consists of roughly forty-three amino acids and ranks among the more abundant small proteins in the cytoplasm. The fragment is much shorter, so it cannot reproduce every function attributed to the intact molecule. In cell culture, short actin-binding motifs can interfere with filament dynamics and cell movement, but such observations come from controlled experiments rather than from whole-animal work. Whether a truncated fragment produces the same effects as the parent protein remains an open question.
Regulatory status differs by country, but TB-500 is not an approved pharmaceutical in major jurisdictions. It is commonly sold as a research chemical for laboratory use, which places responsibility for identity and purity on the supplier and the laboratory. Published human data are limited, and most reports involve preclinical models or cell culture. Questions about whether the fragment mimics all actions of thymosin beta-4, and under which conditions, remain open. Independent verification of any material is therefore a practical requirement in research settings.
TB-500 is a synthetic heptapeptide with the sequence Ac-LKKTETQ. It corresponds to a short N-terminal region of thymosin beta-4, a 43-amino-acid protein found in many cell types. The fragment contains an actin-binding motif, which is one reason it appears in laboratory studies of cell migration and cytoskeletal dynamics. TB-500 is not the full-length protein and is produced as a research chemical rather than an approved therapeutic agent. Its molecular weight is approximately 889 Da.
=== EC 1.2.1 With NAD+ or NADP+ as acceptor === EC 1.2.1.1: deleted, replaced by EC 1.1.1.284, S-(hydroxymethyl)glutathione dehydrogenase and EC 4.4.1.22, S-(hydroxymethyl)glutathione synthase EC 1.2.1.2: Now EC 1.17.1.9, formate dehydrogenase EC 1.2.1.3: aldehyde dehydrogenase (NAD+) EC 1.2.1.4: aldehyde dehydrogenase (NADP+) EC 1.2.1.5: aldehyde dehydrogenase (NAD(P)+) EC 1.2.1.6: deleted (was benzaldehyde dehydrogenase) EC 1.2.1.7: benzaldehyde dehydrogenase (NADP+) EC 1.2.1.8: betaine-aldehyde dehydrogenase EC 1.2.1.9: glyceraldehyde-3-phosphate dehydrogenase (NADP+) EC 1.2.1.10: acetaldehyde dehydrogenase (acetylating) EC 1.2.1.11: aspartate-semialdehyde dehydrogenase EC 1.2.1.12: glyceraldehyde-3-phosphate dehydrogenase (phosphorylating) EC 1.2.1.13: glyceraldehyde-3-phosphate dehydrogenase (NADP+) (phosphorylating) EC 1.2.1.14: Now EC 1.1.1.205, IMP dehydrogenase EC 1.2.1.15: malonate-semialdehyde dehydrogenase EC 1.2.1.16: succinate-semialdehyde dehydrogenase [NAD(P)+] EC 1.2.1.17: glyoxylate dehydrogenase (acylating) EC 1.2.1.18: malonate-semialdehyde dehydrogenase (acetylating) EC 1.2.1.19: aminobutyraldehyde dehydrogenase EC 1.2.1.20: glutarate-semialdehyde dehydrogenase EC 1.2.1.21: glycolaldehyde dehydrogenase EC 1.2.1.22: lactaldehyde dehydrogenase EC 1.2.1.23: 2-oxoaldehyde dehydrogenase (NAD+) EC 1.2.1.24: succinate-semialdehyde dehydrogenase (NAD+) EC 1.2.1.25: branched-chain α-keto acid dehydrogenase system EC 1.2.1.26: 2,5-dioxovalerate dehydrogenase EC 1.2.1.27: methylmalonate-semialdehyde dehydrogenase (CoA-acylating) EC 1.2.1.28: benzaldehyde dehydrogenase (NAD+) EC 1.2.1.29: aryl-aldehyde dehydrogenase EC 1.2.1.30: aryl-aldehyde dehydrogenase (NADP+) EC 1.2.1.31: L-aminoadipate-semialdehyde dehydrogenase EC 1.2.1.32: aminomuconate-semialdehyde dehydrogenase EC 1.2.1.33: (R)-dehydropantoate dehydrogenase EC 1.2.1.34: Now EC 1.1.1.131, mannuronate reductase EC 1.2.1.35: Now EC 1.1.1.203, uronate dehydrogenase EC 1.2.1.36: retinal dehydrogenase EC 1.2.1.37: Now EC 1.17.1.4, xanthine dehydrogenase EC 1.2.1.38: N-acetyl-γ-glutamyl-phosphate reductase EC 1.2.1.39: phenylacetaldehyde dehydrogenase EC 1.2.1.40: part of EC 1.14.13.15, cholestanetriol 26-monooxygenase EC 1.2.1.41: glutamate-5-semialdehyde dehydrogenase EC 1.2.1.42: hexadecanal dehydrogenase (acylating) EC 1.2.1.43: Now EC 1.17.1.10, formate dehydrogenase (NADP+) EC 1.2.1.44: cinnamoyl-CoA reductase EC 1.2.1.45: Now EC 1.1.1.312, 2-hydroxy-4-carboxymuconate semialdehyde hemiacetal dehydrogenase EC 1.2.1.46: formaldehyde dehydrogenase EC 1.2.1.47: 4-trimethylammoniobutyraldehyde dehydrogenase EC 1.2.1.48: long-chain-aldehyde dehydrogenase EC 1.2.1.49: 2-oxoaldehyde dehydrogenase (NADP+) EC 1.2.1.50: long-chain-fatty-acyl-CoA reductase EC 1.2.1.51: pyruvate dehydrogenase (NADP+) EC 1.2.1.52: deleted 2025 (was oxoglutarate dehydrogenase (NADP+)) EC 1.2.1.53: 4-hydroxyphenylacetaldehyde dehydrogenase EC 1.2.1.54: γ-guanidinobutyraldehyde dehydrogenase EC 1.2.1.55: Now EC 1.1.1.279, (R)-3-hydroxyacid-ester dehydrogenase EC 1.2.1.56: Now EC 1.1.1.280, (S)-3-hydroxyacid-ester dehydrogenase EC 1.2.1.57: butanal dehydrogenase EC 1.2.1.58: phenylglyoxylate dehydrogenase (acylating) EC 1.2.1.59: glyceraldehyde-3-phosphate dehydrogenase (NAD(P)+) EC 1.2.1.60: 5-carboxymethyl-2-hydroxymuconic-semialdehyde dehydrogenase EC 1.2.1.61: 4-hydroxymuconic-semialdehyde dehydrogenase EC 1.2.1.62: 4-formylbenzenesulfonate dehydrogenase EC 1.2.1.63: 6-oxohexanoate dehydrogenase EC 1.2.1.64: 4-hydroxybenzaldehyde dehydrogenase (NAD+) EC 1.2.1.65: salicylaldehyde dehydrogenase EC 1.2.1.66: Now EC 1.1.1.306, S-(hydroxymethyl)mycothiol dehydrogenase EC 1.2.1.67: vanillin dehydrogenase EC 1.2.1.68: coniferyl-aldehyde dehydrogenase EC 1.2.1.69: fluoroacetaldehyde dehydrogenase EC 1.2.1.70: glutamyl-tRNA reductase EC 1.2.1.71: succinylglutamate-semialdehyde dehydrogenase EC 1.2.1.72: erythrose-4-phosphate dehydrogenase EC 1.2.1.73: sulfoacetaldehyde dehydrogenase EC 1.2.1.74: abieta-7,13-dien-18-al dehydrogenase EC 1.2.1.75: malonyl CoA reductase (malonate semialdehyde-forming) EC 1.2.1.76: succinate-semialdehyde dehydrogenase (acylating) EC 1.2.1.77: 3,4-dehydroadipyl-CoA semialdehyde dehydrogenase (NADP+) EC 1.2.1.78: 2-formylbenzoate dehydrogenase EC 1.2.1.79: succinate-semialdehyde dehydrogenase (NADP+) EC 1.2.1.80: long-chain acyl-[acyl-carrier-protein] reductase EC 1.2.1.81: sulfoacetaldehyde dehydrogenase (acylating) EC 1.2.1.82: β-apo-4′-carotenal oxygenase EC 1.2.1.83: 3-succinoylsemialdehyde-pyridine dehydrogenase EC 1.2.1.84: alcohol-forming fatty acyl-CoA reductase EC 1.2.1.85: 2-hydroxymuconate-6-semialdehyde dehydrogenase EC 1.2.1.86: geranial dehydrogenase EC 1.2.1.87: propanal dehydrogenase (CoA-propanoylating) EC 1.2.1.88: L-glutamate γ-semialdehyde dehydrogenase EC 1.2.1.89: D-glyceraldehyde dehydrogenase (NADP+) EC 1.2.1.90: glyceraldehyde-3-phosphate dehydrogenase [NAD(P)+] EC 1.2.1.91: 3-oxo-5,6-dehydrosuberyl-CoA semialdehyde dehydrogenase EC 1.2.1.92: 3,6-anhydro-α-L-galactose dehydrogenase EC 1.2.1.93: formate dehydrogenase (NAD+, ferredoxin). Now EC 1.17.1.11, formate dehydrogenase (NAD+, ferredoxin) * EC 1.2.1.94: farnesal dehydrogenase EC 1.2.1.95: L-2-aminoadipate reductase EC 1.2.1.96: 4-hydroxybenzaldehyde dehydrogenase (++) EC 1.2.1.97: 3-sulfolactaldehyde dehydrogenase EC 1.2.1.98: 2-hydroxy-2-methylpropanal dehydrogenase EC 1.2.1.99: 4-(γ-glutamylamino)butanal dehydrogenase EC 1.2.1.100: 5-formyl-3-hydroxy-2-methylpyridine 4-carboxylic acid 5-dehydrogenase EC 1.2.1.101: L-tyrosine reductase EC 1.2.1.102: isopyridoxal dehydrogenase (5-pyridoxate-forming) EC 1.2.1.103: [amino-group carrier protein]-6-phospho-L-2-aminoadipate reductase EC 1.2.1.104: pyruvate dehydrogenase system EC 1.2.1.105: 2-oxoglutarate dehydrogenase system EC 1.2.1.106: [amino-group carrier protein]-5-phospho-L-glutamate reductase EC 1.2.1.107: glyceraldehyde-3-phosphate dehydrogenase (arsenate-transferring)
=== Ehlers–Danlos syndrome hypermobility type === Joint hypermobility is often correlated with hypermobile Ehlers–Danlos syndrome (hEDS, known also by EDS type III or Ehlers–Danlos syndrome hypermobility type (EDS-HT)). Ehlers–Danlos syndrome is a genetic disorder caused by mutations or hereditary genes, but the genetic defect that produces hEDS is largely unknown. In conjunction with joint hypermobility, a common symptom for hEDS is smooth, velvety, and stretchy skin. When diagnosing hEDS, the Beighton Criteria are used, but are not always able to distinguish between joint hypermobility syndrome and hEDS. Ehlers–Danlos hypermobility type can have severe musculoskeletal effects, including:
Glycocyamine (or guanidinoacetate) is a metabolite of glycine in which the amino group has been converted into a guanidine by guanylation (transfer of a guanidine group from arginine). In vertebrate organism it is then transformed into creatine by methylation. Glycocyamine is used as a supplement and as a feed additive in poultry farming. However, the metabolism of creatine from glycocyamine in the liver causes a depletion of methyl groups. This causes homocysteine levels to rise, which has been shown to produce cardiovascular and skeletal problems. Glycocyamine plays a role in the metabolism of the amino acids serine, threonine, and proline.
Sources: en.wikipedia.org
Interactions of the ribosome with long mRNAs containing Shine-Dalgarno sequences were visualized soon after that at 4.5–5.5 Å resolution. In 2023, a cryo-electron microscopy study reported a 1.55 Å structure of the Escherichia coli 70S ribosome in the translating state, providing near-atomic detail of rRNA modifications, tRNA-mRNA interactions, and ion coordination. The high-resolution map enabled identification of ribosomal polymorphism sites and visualization of transient chimeric hybrid states associated with tRNA translocation at approximately 2 Å resolution. These findings improved structural understanding of the ribosome's functional regions and offered valuable insights for antibiotic design. In 2011, the first complete atomic structure of the eukaryotic 80S ribosome from the yeast Saccharomyces cerevisiae was obtained by crystallography. The model reveals the architecture of eukaryote-specific elements and their interaction with the universally conserved core. At the same time, the complete model of a eukaryotic 40S ribosomal structure in Tetrahymena thermophila was published and described the structure of the 40S subunit, as well as much about the 40S subunit's interaction with eIF1 during translation initiation. Similarly, the eukaryotic 60S subunit structure was also determined from Tetrahymena thermophila in complex with eIF6.
=== Types of spasm === A hypertonic muscle spasm is a condition of chronic, excessive muscle tone (i.e., tension in a resting muscle). This is the amount of contraction that remains when a muscle is not working. A true hypertonic spasm is caused by malfunctioning feedback nerves. This is much more serious and is permanent unless treated. In this case, the hypertonic muscle tone is excessive, and the muscles are unable to relax. A subtype of spasm is colic. This is an episodic pain caused by spasm of smooth muscle in a particular organ (e.g., the bile duct). A characteristic of colic is the sensation of having to move about, and the pain may induce nausea or vomiting.
=== Visual effects === Zoic Studios provided visual effects for the series. According to Johns, Stargirl was the first Warner Bros. Television series to use previsualization (a process most commonly used by feature films) for their effects scenes. Previsualization was handled by The Third Floor, Inc. Johns brought his experience working on the films Wonder Woman (2017), Aquaman (2018), and Shazam! (2019) to help the series have visuals not "seen in superhero shows before".
In 1992, Hooters sponsored NASCAR driver Alan Kulwicki as he won the Winston Cup Championship, beating Bill Elliott by ten points, the closest margin in NASCAR prior to The Chase era. On April 1, 1993, Kulwicki, along with several others including Hooters Chairman Bob Brooks's son Mark, were killed in a plane crash near Bristol, Tennessee. They were flying back to the track for Sunday's race after making a sponsor appearance at a Hooters in Knoxville, Tennessee. Hooters remained in the sport, sponsoring drivers like Loy Allen Jr., Rick Mast and Brett Bodine before ending their involvement in 2003. The restaurant returned to NASCAR in 2007 to sponsor a Craftsman Truck Series team led by Jason White, Derrike Cope and Brad Keselowski. Six years later, Hooters sponsored Nationwide Series driver Nelson Piquet Jr.'s car. For the 2016 Bojangles' Southern 500 at Darlington Raceway, Hooters made a comeback in the Cup Series with a one-off paint scheme for Greg Biffle. Hooters most recently sponsored the No. 9 of Chase Elliott from 2017 to 2024. Hooters has sponsored the Major League Eating-sanctioned "Hooters Worldwide Wing Eating Championship" since 2012. Hooters has also licensed its name for the Hooters Road Trip PlayStation racing game. Furthermore, Hooters licensed the Hooters Calendar for Hooters Calendar Girl, a mobile wallpaper application, and Hooters Calendar Girl Tubin', a mobile game, both by Oasys Mobile. It was also one of several real world brands that appeared in the 2011 video game Homefront.
Sources: en.wikipedia.org
Iodine deficiency, most common in inland and mountainous areas, can predispose to goitre – if widespread, known as endemic goitre. Pregnant women deficient of iodine can give birth to infants with thyroid hormone deficiency. The use of iodised salt to add iodine to the diet has eliminated endemic cretinism in most developed countries, and over 120 countries have made the iodination of salt mandatory. Because the thyroid concentrates iodine, it also concentrates the various radioactive isotopes of iodine produced by nuclear fission. In the event of large accidental releases of such material into the environment, the uptake of radioactive iodine isotopes by the thyroid can, in theory, be blocked by saturating the uptake mechanism with a large surplus of non-radioactive iodine, taken in the form of potassium iodide tablets. One consequence of the Chernobyl disaster was an increase in thyroid cancers in children in the years following the accident. Excessive iodine intake is uncommon and usually has no effect on the thyroid function. Sometimes though it may cause hyperthyroidism, and sometimes hypothyroidism with a resulting goitre.
=== Nationalist Republican Party === The Republican Liberal Party (PLR) emerged as the largest party following the 1921 elections, narrowly falling short of winning majorities in both chambers of parliament. However, in the 1922 elections they finished a distant second to the Democratic Party. This defeat led to the PLR seeking other ways of forming a conservative republican coalition capable of defeating the Democratic Party and holding onto power. On 14 May 1922, the PLR convinced Francisco Cunha Leal to join the party. This was viewed as a significant moment, as Cunha Leal was perceived as a hero by PLR members, having tried to save PLR leader António Granjo from assassination during the Bloody Night. After some failed attempts at negotiation with the Reconstitution Party, on 2 December 1922 the two parties formed a coalition in the Chamber of Deputies, led by Álvaro de Castro. This coalition was able to get Alfredo de Sá Cardoso elected President of the Chamber of Deputies due to some representatives of other parties not being present. The two parties formed a coalition in the Senate ten days later. On 4 January 1923 the two parties formally merged, forming the Nationalist Republican Party. At the end of March 1923, members of other small parties such as the Reformist Party (previously led by António Machado Santos) and the National Republican Federation also decided to join the NRP.
== Chemical properties == Copper(II) sulfate pentahydrate decomposes before melting. It loses two water molecules upon heating at 63 °C (145 °F), followed by two more at 109 °C (228 °F) and the final water molecule at 200 °C (392 °F). The chemistry of aqueous copper sulfate is simply that of copper aquo complex, since the sulfate is not bound to copper in such solutions. Thus, such solutions react with concentrated hydrochloric acid to give tetrachlorocuprate(II):
In pre-life, a 31 nucleotide D loop minihelix (GCGGCGGUAGCCUAGCCUAGCCUACCGCCGC) was ligated to two 31 nucleotide anticodon loop minihelices (GCGGCGGCCGGGCU/???AACCCGGCCGCCGC; / indicates a U-turn conformation in the RNA backbone; ? indicates unknown base identity) to form the 93 nucleotide tRNA precursor. To generate type II tRNAs, a single internal 9 nucleotide deletion occurred within ligated acceptor stems (CCGCCGCGCGGCGG goes to GGCGG). To generate type I tRNAs, an additional, related 9 nucleotide deletion occurred within ligated acceptor stems within the variable loop region (CCGCCGCGCGGCGG goes to CCGCC). These two 9 nucleotide deletions are identical on complementary RNA strands. tRNAomes (all of the tRNAs of an organism) were generated by duplication and mutation. Very clearly, life evolved from a polymer world that included RNA repeats and RNA inverted repeats (stem-loop-stems). Of particular importance were the 7 nucleotide U-turn loops (CU/???AA). After LUCA (the last universal common (cellular) ancestor), the T loop evolved to interact with the D loop at the tRNA "elbow" (T loop: UU/CAAAU, after LUCA). Polymer world progressed to minihelix world to tRNA world, which has endured for ~4 billion years. Analysis of tRNA sequences reveals a major successful pathway in evolution of life on Earth.
The fur is soft, with dense underfur and long, coarse, thick guard hairs. The fur is not as shaggy or coarse as that of brown bears. American black bear skins can be distinguished from those of Asian black bears by the lack of a white blaze on the chest and hairier footpads. Despite their name, black bears show a great deal of color variation. Individual coat colors can range from white, blonde, cinnamon, light brown or dark chocolate brown to jet black, with many intermediate variations existing. Silvery-gray American black bears with a blue luster (found mostly on the flanks) occur along a portion of coastal Alaska and British Columbia. White to cream-colored American black bears occur in the coastal islands and the adjacent mainland of southwestern British Columbia. Albino individuals have also been recorded. Black coats tend to predominate in humid areas, such as Maine, New England, New York, Tennessee, Michigan and western Washington. Approximately 70% of all American black bears are black, though only 50% in the Rocky Mountains are black. Many in northwestern North America are cinnamon, blonde or light brown in color and thus may sometimes be mistaken for grizzly bears. Grizzly (and other types of brown) bears can be distinguished by their shoulder hump, larger size and broader, more concave skull. In his book The Great Bear Almanac, Gary Brown summarized the predominance of black or brown/blonde specimens by location:
Sources: en.wikipedia.org
No. TB-500 is a short synthetic peptide matching residues 17 to 23 of thymosin beta-4, while the parent protein contains 43 residues. The fragment lacks the rest of the protein sequence, so the two are related but not identical.
It consists of leucine, lysine, lysine, threonine, glutamic acid, threonine, and glutamine in that order. The N-terminal leucine is usually acetylated in the forms described in catalogues.
Controlled human data is limited, and most published findings come from cell culture or animal work. This makes it difficult to state clinical effects with confidence.
The most common approach is liquid chromatography with tandem mass spectrometry after extraction from blood or urine. Immunoassays exist but are generally treated as screening tools because of cross-reactivity.